Oral 'hydrogen water' induces neuroprotective ghrelin secretion in mice

Oral ‘hydrogen water’induces

neuroprotective ghrelin secretion in mice

Akio Matsumoto 1,2,5*,Megumi Yamafuji 3*,Tomoko Tachibana 1,Yusaku Nakabeppu 4,5,Mami Noda 3,5&Haruaki Nakaya 1

1

Department of Pharmacology,Graduate School of Medicine,Chiba University,Chiba,2Division of Molecular Design,Medical Institute of Bioregulation,Kyushu University,Fukuoka,3Laboratory of Pathophysiology,Graduate School of Pharmaceutical

Sciences,Kyushu University,Fukuoka,4Division of Neurofunctional Genomics,Medical Institute of Bioregulation,Kyushu University,Fukuoka,5Research Center for Nucleotide Pool,Kyushu University,Fukuoka,Japan.

The therapeutic potential of molecular hydrogen (H 2)is emerging in a number of human diseases and in their animal models,including in particular Parkinson’s disease (PD).H 2supplementation of drinking water has been shown to exert disease-modifying effects in PD patients and neuroprotective effects in experimental PD model mice.However,H 2supplementation does not result in detectable changes in striatal H 2levels,indicating an indirect effect.Here we show that H 2supplementation increases gastric expression of mRNA encoding ghrelin,a growth hormone secretagogue,and ghrelin secretion,which are antagonized by the b 1-adrenoceptor blocker,atenolol.Strikingly,the neuroprotective effect of H 2water was abolished by either administration of the ghrelin receptor-antagonist,D-Lys 3GHRP-6,or atenolol.Thus,the

neuroprotective effect of H 2in PD is mediated by enhanced production of ghrelin.Our findings point to potential,novel strategies for ameliorating pathophysiology in which a protective effect of H 2supplementation has been demonstrated.

T

herapeutic applications of molecular hydrogen (H 2)have been reported in a variety of human diseases and their animal models 1,including ischemia-reperfusion injury 2–4,metabolic syndrome 5,diabetes mellitus type 26,organ transplantation 7–9,reduction of adverse effects of anti-tumor drug therapy 10,11and radiation therapy 12,13.Although the mechanism of action of H 2has not been clearly demonstrated,it is assumed that its anti-oxidative properties,particularly against hydroxyl radical (?OH)and peroxinitrite (ONOO 2),are likely to underlie therapeutic efficacy 2.Unlike other medical-gas therapy,H 2can be applied in air for inhalation or in solution for drinking,intravenous injection or dialysis.Whereas intravenous injection or dialysis delivers H 2directly into the blood stream,oral hydrogen-supplemented water (hydrogen water,H 2-water)must be absorbed into the circulation resulting in limited H 2concentrations in the blood and in target organs 7,14.

Parkinson’s disease (PD)has been a major focus in the field of oxidative stress and disease,because it is thought that degeneration of dopaminergic neurons can be triggered and aggravated by the accumulation of oxidative damage.However,although antioxidant therapies have been assessed in PD patients,clinical efficacy has not been established 15,16.In contrast,a pilot study of hydrogen water therapy in PD patients has shown promising results 17,and it has been reported that hydrogen water exhibits neuroprotective effects 14in the murine MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine)-induced PD model 18.H 2levels were below measurable thresholds in the substantia nigra in PD model mice 14,and hydrogen water,but not continuous inhalation of 2%H 2,prevented the development of PD in a rat model 19.These findings suggest that the therapeutic effects of hydrogen water may not require its anti-oxidant activity in the brain,and further that its efficacy requires processing that is consequent upon oral administration.

The purpose of the present study was to employ PD model mice to elucidate the underlying mechanism of the neuroprotective effects of oral H 2-water.In particular,we hypothesized that oral H 2induces a messenger molecule,which travels to the brain and exerts neuroprotective activity.

Results

Oral hydrogen water induces ghrelin gene expression in the stomach .The stomach functions as an endocrine organ that secretes various peptide hormones with a broad range of physiological effects.We first focused on the stomach to investigate possible effects of oral H 2-water at the level of gene induction.In a previous study 14,it was reported that drinking H 2-water for a period of 7days prior to MPTP injection protected against MPTP toxicity.We administered oral H 2-water for 4consecutive days and analyzed expression in stomach tissue of gastrin,

OPEN

SUBJECT AREAS:

TARGET IDENTIFICATION EXPERIMENTAL MODELS OF

DISEASE

ENDOCRINOLOGY PARKINSON’S DISEASE

Received 2July 2013Accepted

1November 2013Published

20November 2013

Correspondence and requests for materials should be addressed to A.M.(akio@faculty.

chiba-u.jp)

*These authors contributed equally to

this work.

somatostatin,and ghrelin by real-time PCR method.Levels of ghrelin mRNA increased 1.9-fold in H 2-water-treated versus control mice (Figure 1),whereas no effects of hydrogen water were detected on expression of the somatostatin gene (expressed only at trace levels)or the gastrin gene (expression of which was highly variable from individual to individual)(not shown).

To examine the time-course of ghrelin induction by hydrogen water,mice were administered hydrogen water or control water once a day for 0(control)1,2or 4days and ghrelin levels were measured by ELISA in plasma derived from blood obtained 4–5hours after the final administration of H 2-or control water.Only mice that received H 2water for 4-day exhibited a significant increase in plasma ghrelin level,although mice administered hydrogen water for 2-day showed a non-significant increase (Figure 2).

b 1-adrenergi

c receptor signaling mediates enhancement of ghre-lin secretion by oral hydrogen water .It has been shown that gastric secretion of ghrelin is regulate

d by local environmental cues inclu-ding blood glucose,estrogen,insulin and catecholamines 20–22.In particular,it has been reported that b 1-adrenergic receptor stimula-tion increases ghrelin secretion in vitro and in vivo 22,23.W

e verified the expression o

f b 1-and b 2-adrenergic receptors in stomach tissue samples by real-time PCR method,and determined that there were no significant changes in the levels of expression after administration of oral H 2-water for 4days (data not shown).The increase in plasma ghrelin levels by oral hydrogen water was eliminated by administra-tion of the b 1-adrenergic receptor-specific blocker,atenolol (10mg/k

g i.p.)injected 30min prior to H 2water administration on eac

h of four days (Figure 3).Thus,activation of b 1-adrenergic receptors is required for hydrogen water-induced enhancement of circulating ghrelin.

Blockades of ghrelin action abrogates the protective effect of H 2water in PD model mice .In a previous report,oral H 2-water exhibited significant protective effects in MPTP-induced PD model mice against the loss of dopaminergic neurons from the substantia nigra 14.To test directly the role of ghrelin,either the growth hormone

secretagogue receptor antagonist,D-Lys 3GHRP-6(100nmol/day i.p.),or b 1-adrenoceptor blocker,atenolol (10mg/kg i.p.),was administered along with control or hydrogen water for 7days prior to administration of MPTP.Loss of dopaminergic neurons from the substantia nigra was evaluated seven days following admi-nistration of MPTP.As shown in Figure 4,systemic administration of MPTP caused a significant loss of dopaminergic neurons from the pars compacta of the substantia nigra (SNpc)as assessed by immu-nohistochemical detection of tyrosine hydroxylase (TH)(a),and further confirmed by immunological detection of TH protein

in

Figure 1|Oral H 2water increases ghrelin gene expression in the mouse stomach.Control water,or H 2water (0.8ml/mouse)made with a stick of magnesium (about 0.04mM H 2;see Methods),was administered to mice (41–48weeks of age;n 54per group)once a day for 4days.Three hr after the final ingestion,the stomach was removed and prepared for qPCR.Data were normalized with respect to expression of RPL4mRNA and are represented as mean 6

SEM.

Figure 2|Plasma ghrelin levels following administration of oral H 2

water.Mice (16–21weeks,average 18.5weeks,n 55–10)received H 2water (or control water)as in Fig.1for 1,2or 4d.Blood was collected on the final day of the experiment,4hr after the last ingestion,and plasma levels of ghrelin were quantified by ELISA.Panel shows data from male mice.The ghrelin level was significantly higher only in the group of mice drinking H 2water for 4d.Data are represented as mean 6

SEM.

Figure 3|H 2water increases plasma ghrelin levels in a b 1-adrenergic receptor-dependent manner.Plasma ghrelin levels were measured on the last day of experiment.Each group of mice (11–13weeks of age;n 54–5for each group)was administered control water or H 2water (made with an open-air water electrolysis system)once a day for 4d with or without i.p.injection of atenolol (10mg/kg)prior to water ingestion.The H 2water group showed a significant increase in plasma ghrelin level compared to the control group (*p 50.038),which was abrogated by pretreatment with atenolol (**p 50.039).Datafare represented as mean 6SEM.

the substantia nigra with actin as control (b),and stereological analysis (c).Whereas administration of H 2water alone in control mice had no effect,the loss of dopaminergic neurons in MPTP-treated mice was significantly decreased by administration of hydrogen water,as previously reported 14.Strikingly,although admi-nistration of D-Lys 3GHRP-6or atenolol in control mice had no effect alone and D-Lys 3GHRP-6or atenolol did not affect MPTP-induced loss of dopaminergic neurons,the protective effects of hydrogen water were eliminated by either one of D-Lys 3GHRP-6or atenolol.Thus,induction of gastric ghrelin production and sub-sequent activation of ghrelin-initiated signal transduction underlies the protective effects of hydrogen water in the MPTP model of PD.

Discussion

Our findings demonstrate that the neuroprotective effects of oral hydrogen water,which produces negligible levels of H 2in the brain,result from gastric induction of the neuroprotective peptide hor-mone ghrelin and the subsequent activation of ghrelin receptors.In addition,we have shown an obligate role for b 1-adrenergic

receptors in hydrogen water-induced ghrelin up-regulation in plasma,consistent with previous reports that adrenergic stimulation regulates ghrelin release in vitro and in vivo 22,24,25.

The neuroprotective effects of ghrelin in PD are well-established 26,and it has been demonstrated that the receptor for ghrelin,the growth hormone secretagogue receptor (GHSR),is highly expressed by dopaminergic neurons of the substantia nigra 27.It has been sug-gested that ghrelin protects nigrostriatal dopamine neurons via an uncoupling protein 2(UCP2)-dependent mitochondrial mech-anism 28,29.However,we found that the expression of neither UCP2mRNA nor protein was significantly upregulated by administration of H 2water drinking for 7days (data not shown).This finding suggests an alternative signaling mechanism downstream of GHSR activation,perhaps involving PI3K/Akt 30.

It was reported that administration of saturated hydrogen water (approx.0.8mM)led to symptomatic improvement in PD patients 17.Administration of hydrogen water at about 0.05%saturation suc-cessfully maintained dopaminergic neurons in MPTP-induced PD model mice 14.We employed three different methods to

prepare

200μm

Figure 4|Inhibition of ghrelin secretion or the ghrelin receptor antagonist cancels the neuroprotective effect of oral H 2water in MPTP-induced Parkinson’s disease model mice (male,8–12weeks,n 52–5for each group).Saturated H 2water was made daily as described in materials and methods.(a):Tyrosine hydroxylase (TH)staining was performed in substantia nigra pars compacta from saline-injected (i–iv),D-Lys 3GHRP-6-injected (v–viii),and atenolol-injected (ix–xii)mice,supplied with either normal tap water (control)or H 2water for 7days.MPTP was injected (i.p.)after 7days of D-Lys 3GHRP-6,atenolol,or saline-injection (ii,iv,vi,viii,x,and xii).(b):Summary of the immunoblotting analysis of TH protein in the substantia nigra tissue (n 53–6for each group)and the representative blot images were shown underneath (two samples per group).The TH band intensity was normalized to the band of actin on the same sample.(##p 50.007,i vs.ii;0.010,ii vs.iv;0.004,vi vs.vii;#p 50.043,iv vs.viii;0.023,v vs.vi).Data in figures are represented as mean 6SEM.(c):Summary of the stereological analysis of nigral dopaminergic neurons.Although MPTP injections caused significant loss of TH-positive neurons (ii)(**p 50.0001,i vs.ii),drinking H 2water for 7days prior to MPTP-treatment significantly attenuates the loss of TH-positive cells (iv)(#p 50.008,ii vs.iv).D-Lys 3GHRP-6,growth hormone secretagogue receptor antagonist,or b 1-adrenoceptor blocker,atenolol,canceled the preservation effect of oral H 2water (viii and xii)(#p 50.008;ii vs.iv;p 50.003,iv vs.viii;p 50.0003,iv vs.xii).Data in figures are represented as mean 6SEM.The statistical significance of data was assessed by one-way ANOVA followed by Benferroni test.

hydrogen water (see Methods),which resulted in H 2concentration of 0.04–0.8mM,and we observed that the effects of hydrogen water on ghrelin induction and protection of dopamine neurons were dose-independent over this range.Thus,small amounts of oral H 2are sufficient for gastric induction of ghrelin and subsequent neuro-protection,in the absence of detectable H 2in the brain.Interestingly,gut microbes can produce molecular hydrogen constitutively and lactulose,a synthetic disaccharide,is an effective substrate to enhance bacterial H 2production in the colon 31.However,ingestion of lactu-lose had no significant effect on dopaminergic neuron survival in 6-OHDA-induced PD model rats (although alveolar H 2concentrations were elevated)19.These results emphasize the importance of gastric ghrelin induction in the neuroprotective action of H 2.Oral H 2-water is being explored as a therapeutic for PD as well as a variety of other human pathophysiological conditions 17,32,33under the generally held assumption that the mechanism of action of supplemental H 2is likely to reflect an antioxidative role.Our findings that oral H 2water exerts a neuroprotective effect through activation of an endogenous,gastric ghrelin system that is tightly coupled to b -adrenergic receptor signaling suggests the possibility of novel applications of H 2therapy for various diseases.

Methods

Animals .Procedures in animal experiments were approved by the university review board for animal care in Chiba University and Kyushu University,and performed in accordance with the guidelines established by the Science Council of Japan.All mice (C57BL/6J)were maintained in the animal facility under controlled temperature and lighting (12-hour light,12-hour dark),and received a standard mouse chow diet and filter-sterilized tap water ad libitum .

Preparation and administration of H 2-water .H 2water was prepared by one of three methods.The first method utilized the spontaneous ionization reaction of magnesium in water 14.A magnesium stick (AZ31,Nakagawa Metal,Japan,composed of 96%magnesium,3%aluminum,and 1%zinc)was polished to remove the oxidized surface and wiped clean with 1N hydrogen chloride before dipping into drinking water for 15–20min at 25u C.The second method was based on the electrolysis of water with platinum electrodes at 150V DC for 20min (open-air water electrolysis method).The anode was placed inside a drinking straw to vent generated oxygen.In the third method (employed in the experiments with MPTP-induced PD model mice),H 2gas was produced by solid polymer electrolyte water electrolysis method at 5V DC in which the cathode and anode were separated by a solid polymer electrolyte membrane (Nafion H E.I.,du Pont de Nemours &Co.,Inc.)and collected through a polyethylene tube.Saturated H 2water was then generated by bubbling water in a drinking bottle with H 2gas such that H 2gas filled the headspace.H 2water made with this method and kept in sealed drinking bottles remained saturated with H 2for at least 24hr.

In most experiments,each mouse received 0.8ml of H 2water (administered within 30min of preparation)or control water (obtained by boiling H 2water to degas)once every morning via feeding needle according to the experimental schedule.In

experiments with MPTP-induced PD model mice,fresh H 2water was supplied every 24hr and water intake was ad libitum for the 7days prior to MPTP administration.Measurements of ghrelin expression .Male and female mice aged between 41and 48weeks were chosen for the initial screening for the altered expression of gastric enzymes (n 54for each group),as they are relatively stable in dietary intake,which may influence mostly on the digestive enzyme expressions.Since the previous study was done with male mice 14,the following experiments chose male mice.For the time-course analysis of ghrelin induction by hydrogen water,male mice (16–21weeks,

average 17.9weeks,n 55–10in each group)were selected.Adrenoceptor mediated changes of ghrelin secretion was analyzed in male mice (age between 11–13weeks,n 54–5for each group).Of note,there was no body weight change more than one gram during the period of experiment (4days).These results are in line with the previous report with a recombinant ghrelin injection to mice,where the body weight change was below one gram in three days 34.

Mice were administrated H 2water or control water for 4days according to the experimental schedule.At the end of the experiment,mice were sacrificed by cervical dislocation and blood was collected by cardiopuncture with EDTA as anti-coagulant.Blood was centrifuged at 2000g for 5min at 4u C and the plasma was collected and mixed with 1N hydrogen chloride (10%of plasma volume)to avoid inactivating deacylation of ghrelin 20.Samples were stored at 280u C until analysis.Following blood collection,the stomach was removed intact and snap-frozen in liquid nitrogen for further analysis.For consistency,mice were killed 4–5hours after the final

administration of H 2water and at the same time of day.At the time of blood sampling the stomach was almost full of chow,which suggests that the water administration at a time (0.8ml/time)through the feeding needle did not cause the sustained reduction on appetite.

The active form of ghrelin was measured in plasma by ELISA (Active Ghrelin ELISA kit,Sceti,Japan)according to the manufacturer’s instructions.For semi-quantitative PCR,stomach tissue frozen in liquid nitrogen was crushed into fine granules and total RNA was extracted with RNAiso (Takara,Japan)according to the manufacturer’s instructions.Two m g of total RNA was then used to synthesize first strand cDNA with a SuperScript VILO cDNA Synthesis Kit (Invitrogen,USA).mRNA expression levels were quantified by real-time PCR with SYBR green dye (Thunderbird Sybr qPCR Mix,Toyobo,Japan)with the specific primer sets shown in Table 1,and normalized to ribosomal protein L4(RPL4)mRNA 35–37.

Administration of ghrelin receptor antagonist,b 1-adrenoceptor blocker,and MPTP .The ghrelin receptor antagonist,D-Lys 3GHRP-6(Sigma-Aldrich,USA;100nmol/day),b 1-adrenoceptor blocker,atenolol (ICI,USA;10mg/kg),or saline was administered by i.p.injection daily for 7days in conjunction with supplying fresh control or H 2water.On day 7,MPTP-HCl (Sigma-Aldrich,USA;15mg/kg in 0.9%NaCl per injection)or saline as control was administrated by i.p.injection four times at 2hr intervals.Mice were supplied with untreated tap water for the next 7days before removal of brains under deep anesthesia (pentobarbital,50mg/kg i.p.).Stereological and immunological analyses of nigral dopaminergic neurons .Stereological analysis was carried out as described 14,38–40.In brief,coronal sections (30m m thickness)were obtained through SNpc (22.70mm to 23.80mm relative to bregma)41with a MICROM cryostat.Free-floating sections were incubated with Block Ace (Dainippon Pharmaceutics,Japan)for 30min followed by incubation with anti-tyrosine hydroxylase (TH)antibody (Chemicon,USA,153000in 10%Block Ace)for 2days at 4u C.After rinsing,sections were immersed in a solution of 3%H 2O 2in methanol/PBS (151)for 10min at room temperature,followed by incubation for 2hr in biotinylated goat anti-rabbit IgG (15400,Vector,USA)and processing with a Vectastain ABC kit (Vector,USA)using 3939-diaminobenzidinetetrahydrochloride (DAB,Vector,USA)as peroxidase chromogen.

Unbiased stereological counts of TH-immunoreactive cell bodies in the SNpc were obtained using an optical fractionator method 42and Stereo Investigator software (Stereo Investigator 8,MicroBrightField Inc.,USA).The boundary of SNpc was delineated under 1003magnification and immunopositive neurons were counted in every third section (eight sections per brain)at 4003magnification on a Nikon ECLIPSE 80i microscope using a grid of 70370m m on a counting grid (753100312m m)with 2m m upper and lower guard zones.Gundersen’s coefficient of error in all samples was ,0.07.

Immunological detection and quantification of TH expression in the substantia nigra tissue were performed by western blotting with actin as control.Animals were prepared identically to those of the stereological analysis.The substantia nigra was removed and stored at 280u C until use.Samples were lysed on ice in hypotonic buffer (20mM Hepes pH 7.6,10mM NaCl,1.5mM MgCl 2,1mM EDTA,0.1%Triton X-100)with protease inhibitor cocktail (Roche,USA),and cleared by a centrifugation at 20k G for 10min at 4u C.Following quantification of protein concentration using the BCA method with BSA as control,five m g of tissue lysate reduced in sample buffer was resolved by 10%SDS-PAGE,transferred to nitrocellulose membrane,and probed with anti-TH antibody (152000)overnight at 4u C.Proteins were visualized using anti-rabbit secondary antibody conjugated to HRP and a chemiluminescence

detection system (Immobilon Western Chemiluminescent HRP Substrate,Millipore,USA).Chemiluminescence image was quantified by Gauge application (Fuji Film,Japan)and the value was normalized to the level of actin band on the same sample specified by anti-Actin monoclonal antibody (Clone C4,Millipore,USA).Statistical analysis and data managing .The statistical significance of data was assessed by unpaired Student t-test (two-tailed)unless otherwise mentioned and results were considered significant at p #0.05.

1.Ohta,S.Recent Progress Toward Hydrogen Medicine:Potential of Molecular Hydrogen for Preventive and Therapeutic Applications.Curr.Pharm.Des.17,2241–2252(2011).

2.Ohsawa,I.et al .Hydrogen acts as a therapeutic antioxidant by selectively reducing cytotoxic oxygen radicals.Nat.Med.13,688–94

(2007).

Table 1|Primer sets used for real-time PCR analyses

RPL4.For GCCAAGACTATGCGCAGGAAT RPL4.Rev GTAGCTGCTGCTTCCAGCTT Ghrelin.For TCAAGCTGTCAGGAGCTCAGTA Ghrelin.Rev

TTGTCAGCTGGCGCCTCTT Somatostatin.For TGGCTGCGCTCTGCATCGT Somatostatin.Rev AGTACTTGGCCAGTTCCTGTT Gastrin.For CAGCGCCAGTTCAACAAGCT Gastrin.Rev ATTCGTGGCCTCTGCTTCTT b1AR.For CACTGTGGACAGCGATTCGA b1AR.Rev ACCTTGGACTCCGAGGAGAA b2AR.For ACAGGAACTGCTGTGTGAGGAT b2AR.Rev

ACGCTAAGGCTAGGCACAGT

3.Hayashida,K.et al.H2gas improves functional outcome after cardiac arrest to an

extent comparable to therapeutic hypothermia in a rat model.J.Am.Heart Assoc.

1,e003459(2012).

4.Fukuda,K.et al.Inhalation of hydrogen gas suppresses hepatic injury caused by

ischemia/reperfusion through reducing oxidative stress.Biochem.Biophys.Res.

Commun.361,670–4(2007).

5.Kamimura,N.,Nishimaki,K.,Ohsawa,I.&Ohta,S.Molecular hydrogen

improves obesity and diabetes by inducing hepatic FGF21and stimulating energy metabolism in db/db mice.Obesity(Silver Spring).19,1396–403(2011).

6.Kajiyama,S.et al.Supplementation of hydrogen-rich water improves lipid and

glucose metabolism in patients with type2diabetes or impaired glucose tolerance.

Nutr.Res.28,137–43(2008).

7.Cardinal,J.S.et al.Oral hydrogen water prevents chronic allograft nephropathy in

rats.Kidney Int.77,101–109(2009).

8.Kawamura,T.et al.Inhaled hydrogen gas therapy for prevention of lung

transplant-induced ischemia/reperfusion injury in rats.Transplantation90, 1344–51(2010).

9.Buchholz,B.M.et al.Hydrogen inhalation ameliorates oxidative stress in

transplantation induced intestinal graft injury.Am.J.Transplant8,2015–24 (2008).

10.Nakashima-Kamimura,N.,Mori,T.,Ohsawa,I.,Asoh,S.&Ohta,S.Molecular

hydrogen alleviates nephrotoxicity induced by an anti-cancer drug cisplatin without compromising anti-tumor activity in mice.Cancer Chemother.

Pharmacol.64,753–61(2009).

11.Matsushita,T.,Kusakabe,Y.,Kitamura,A.,Okada,S.&Murase,K.Investigation

of protective effect of hydrogen-rich water against cisplatin-induced

nephrotoxicity in rats using blood oxygenation level-dependent magnetic

resonance imaging.Jpn.J.Radiol.29,503–12(2011).

12.Qian,L.et al.Radioprotective effect of hydrogen in cultured cells and mice.Free

Radic.Res.44,275–82(2010).

13.Schoenfeld,M.P.et al.Hydrogen therapy may reduce the risks related to

radiation-induced oxidative stress in space flight.Med.Hypotheses76,117–8 (2011).

14.Fujita,K.et al.Hydrogen in drinking water reduces dopaminergic neuronal loss in

the1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mouse model of Parkinson’s disease.PLoS One4,e7247(2009).

15.Jenner,P.Oxidative stress in Parkinson’s disease.Ann.Neurol.53Suppl3,

S26–36;discussion S36–8(2003).

16.Dexter,D.T.&Jenner,P.Parkinson disease:from pathology to molecular disease

mechanisms.Free Radic.Biol.Med.62,132–44(2013).

17.Yoritaka,A.et al.Pilot study of H2therapy in Parkinson’s disease:A randomized

double-blind placebo-controlled trial.Mov.Disord.28,836–9(2013).

18.Heikkila,R.E.,Hess,A.&Duvoisin,R.C.Dopaminergic neurotoxicity of1-

methyl-4-phenyl-1,2,5,6-tetrahydropyridine in mice.Science224,1451–3(1984).

19.Ito,M.et al.Drinking hydrogen water and intermittent hydrogen gas exposure,

but not lactulose or continuous hydrogen gas exposure,prevent6-

hydorxydopamine-induced Parkinson’s disease in rats.Med.Gas Res.2,15

(2012).

20.Kojima,M.&Kangawa,K.Ghrelin:structure and function.Physiol.Rev.85,

495–522(2005).

21.Kamegai,J.et al.Effects of insulin,leptin,and glucagon on ghrelin secretion from

isolated perfused rat stomach.Regul.Pept.119,77–81(2004).

22.Zhao,T.et al.Ghrelin secretion stimulated by b1-adrenergic receptors in cultured

ghrelinoma cells and in fasted mice.Proc.Natl.Acad.Sci.U.S.A.107,15868–73 (2010).

23.Gagnon,J.&Anini,Y.Insulin and norepinephrine regulate ghrelin secretion from

a rat primary stomach cell culture.Endocrinology153,3646–56(2012).

24.Gagnon,J.&Anini,Y.Glucagon stimulates ghrelin secretion through the

activation of MAPK and EPAC and potentiates the effect of norepinephrine.

Endocrinology154,666–74(2013).

25.Iwakura,H.et al.Oxytocin and dopamine stimulate ghrelin secretion by the

ghrelin-producing cell line,MGN3-1in vitro.Endocrinology152,2619–25(2011).

26.Andrews,Z.B.The extra-hypothalamic actions of ghrelin on neuronal function.

Trends Neurosci.34,31–40(2011).

27.Zigman,J.M.,Jones,J.E.,Lee,C.E.,Saper,C.B.&Elmquist,J.K.Expression of

ghrelin receptor mRNA in the rat and the mouse https://www.sodocs.net/doc/156497026.html,p.Neurol.494, 528–48(2006).

28.Andrews,Z.B.et al.UCP2mediates ghrelin’s action on NPY/AgRP neurons by

lowering free radicals.Nature454,846–51(2008).

29.Andrews,Z.B.et al.Ghrelin promotes and protects nigrostriatal dopamine

function via a UCP2-dependent mitochondrial mechanism.J.Neurosci.29,

14057–65(2009).30.Murata,M.et al.Ghrelin modulates the downstream molecules of insulin

signaling in hepatoma cells.J.Biol.Chem.277,5667–74(2002).

31.Florent,C.et al.Influence of chronic lactulose ingestion on the colonic

metabolism of lactulose in man(an in vivo study).J.Clin.Invest.75,608–13 (1985).

32.Ishibashi,T.et al.Consumption of water containing a high concentration of

molecular hydrogen reduces oxidative stress and disease activity in patients with rheumatoid arthritis:an open-label pilot study.Med.Gas Res.2,27(2012). 33.Kang,K.-M.et al.Effects of drinking hydrogen-rich water on the quality of life of

patients treated with radiotherapy for liver tumors.Med.Gas Res.1,11(2011).

34.Zhang,W.,Majumder,A.,Wu,X.&Mulholland,M.W.Regulation of food intake

and body weight by recombinant proghrelin.Am.J.Physiol.Endocrinol.Metab.

297,E1269–75(2009).

35.Nygard,A.,J?rgensen,C.B.,Cirera,S.&Fredholm,M.Selection of reference

genes for gene expression studies in pig tissues using SYBR green qPCR.BMC Mol.Biol.8,67(2007).

36.Steinau,M.,Rajeevan,M.S.&Unger,E.R.DNA and RNA references for qRT-

PCR assays in exfoliated cervical cells.J.Mol.Diagn.8,113–8(2006).

37.Gao,C.et al.Sensitivity of heterozygous a1,6-fucosyltransferase knock-out mice

to cigarette smoke-induced emphysema:implication of aberrant transforming growth factor-b signaling and matrix metalloproteinase gene expression.J.Biol.

Chem.287,16699–708(2012).

38.Kajitani,K.et al.Galectin-1promotes basal and kainate-induced proliferation of

neural progenitors in the dentate gyrus of adult mouse hippocampus.Cell Death Differ.16,417–27(2009).

39.Mallajosyula,J.K.et al.Correction:MAO-B Elevation in Mouse Brain Astrocytes

Results in Parkinson’s Pathology.PLoS One7,16(2012).

40.Mount,M.P.et al.Involvement of interferon-gamma in microglial-mediated loss

of dopaminergic neurons.J.Neurosci.27,3328–37(2007).

41.Paxinos,G.&Franklin,K.B.J.The mouse brain in stereotaxic coordinates.2nd,

(Academic Press,2001).

42.West,M.J.,Slomianka,L.&Gundersen,H.J.Unbiased stereological estimation of

the total number of neurons in thesubdivisions of the rat hippocampus using the optical fractionator.Anat.Rec.231,482–97(1991). Acknowledgments

The authors are grateful to Dr.Douglas T.Hess(Case Western Reserve Univ.)for valuable advice and critical reading of the manuscript,and Dr.Yoshinori Tanaka(Corporate Engineering Division,Appliances Company,Panasonic Corporation,Japan)for help with hydrogen measurement.The authors also acknowledge the technical support of Mr. Yuichiro Kojima(Kyushu Univ.).This work was partly performed in the Cooperative Research Project Program of the Medical Institute of Bioregulation,Kyushu University. This work is supported in part by Grant-in-Aid for Scientific Research on Innovative Areas (MEXT20117008to A.M.),Grant-in-Aid for Exploratory Research(JSPS24659111to A.M.),Grant-in-Aid for Scientific Research(B)(JSPS23390053to H.N.),Grant-in-Aid for Scientific Research(S)(JSPS22221004to Y.N.),Grant-in-Aid for Scientific Research(C) (JSPS22590084to M.N.)and Academic Challenge in Robert T.Huang Entrepreneurship of Kyushu University(to M.Y.).

Author contributions

A.M.,Y.N.,and M.N.conception and design of research;A.M.,M.Y.,T.T.performed experiments;A.M.,M.Y.,and M.N.analyzed data;A.M.,M.Y.,Y.N.,and M.N.interpreted results of experiments;A.M.and M.Y.prepared figures;A.M.,M.Y.,Y.N.,M.N.,and H.N. wrote and revised manuscript;A.M.,M.Y.,T.T.,Y.N.,M.N.,and H.N.approved final version of manuscript.

Additional information

Competing financial interests:The authors declare no competing financial interests. How to cite this article:Matsumoto,A.et al.Oral‘hydrogen water’induces neuroprotective ghrelin secretion in mice.Sci.Rep.3,3273;DOI:10.1038/srep03273(2013).

This work is licensed under a Creative Commons Attribution-

NonCommercial-NoDerivs3.0Unported license.To view a copy of this license, visit

https://www.sodocs.net/doc/156497026.html,/licenses/by-nc-nd/3.0