王跃进 VpWRKY3, a biotic and abiotic stress-related transcription factor

ORIGINAL PAPER

VpWRKY3,a biotic and abiotic stress-related transcription factor from the Chinese wild Vitis pseudoreticulata

Ziguo Zhu?Jiangli Shi?Jiangling Cao?

Mingyang He?Yuejin Wang

Received:21May2012/Revised:11July2012/Accepted:13July2012

óSpringer-Verlag2012

Abstract Chinese wild grapevine Vitis pseudoreticulata accession‘Baihe-35-1’is identi?ed as the precious resource with multiple resistances to pathogens.A directional cDNA library was constructed from the young leaves inoculated with Erysiphe necator.A total of3,500clones were sequenced,yielding1,727unigenes.Among them,762 unigenes were annotated and classi?ed into three classes, respectively,using Gene Ontology,including22ESTs related to transcription regulator activity.A novel WRKY transcription factor was isolated from the library,and des-ignated as VpWRKY3(GenBank Accession No.JF500755). The full-length cDNA is1,280bp,encoding a WRKY protein of320amino acids.VpWRKY3is localized to nucleus and functions as a transcriptional activator.QRT-PCR analysis showed that the VpWRKY3speci?cally accumulated in response to pathogen,salicylic acid,ethyl-ene and drought stress.Overexpression of VpWRKY3in tobacco increased the resistance to Ralstonia solanacearum, indicating that VpWRKY3participates in defense response. Furthermore,VpWRKY3is also involved in abscisic acid signal pathway and salt stress.This experiment provided an important basis for understanding the defense mechanisms mediated by WRKY genes in China wild grapevine.Gen-eration of the EST collection from the cDNA library pro-vided valuable information for the grapevine breeding. Key message We constructed a cDNA library from Chinese wild grapevine leaves inoculated with powdery mildew. VpWRKY3was isolated and demonstrated that it was involved in biotic and abiotic stress responses. Keywords Chinese Vitis pseudoreticulataá

cDNA libraryáTranscription factoráWRKYá

Biotic and abiotic stresses

Introduction

Plants are exposed to all kinds of attacks in nature, including pathogens and extreme changes of temperature, light and water,which leads to changes in gene expression and metabolism,and induces multiple interactions in plants, thus becoming a research focus for many years.Grapevine, as an important fruit species,is cultivated worldwide to produce wine,juice,raisins and table grapes.However, fungal pathogens such as powdery mildew and downy mildew have caused large damage to grapevine production. Even though chemical prevention and control was effective in production,it increased production cost and caused serious environmental pollution,especially,increased the pesticide residue which was harmful to human

health. Communicated by A.Feher.

Z.Zhu and J.Shi contributed equally to this work.

Electronic supplementary material The online version of this

article(doi:10.1007/s00299-012-1321-1)contains supplementary

material,which is available to authorized users.

Z.ZhuáJ.ShiáJ.CaoáM.HeáY.Wang

College of Horticulture,Northwest A&F University,

Yangling712100,Shaanxi,People’s Republic of China

Z.ZhuáJ.ShiáJ.CaoáM.HeáY.Wang

Key Laboratory of Biology and Genetic Improvement

of Horticultural Crops(Northwest Region),Ministry

of Agriculture,Beijing,People’s Republic of China

Z.ZhuáJ.ShiáJ.CaoáM.HeáY.Wang(&)

State Key Laboratory of Crop Stress Biology in Arid Areas,

Northwest A&F University,Yangling712100,

Shaanxi,People’s Republic of China

e-mail:wangyj@https://www.sodocs.net/doc/0614666750.html,

123 Plant Cell Rep

DOI10.1007/s00299-012-1321-1

Therefore,making use of plant resistance itself and culti-vating new resistant species is the most effective way. Unfortunately,cultivated grapevine Vitis vinifera is highly susceptible to fungal pathogens.China is one of the major centers of origin of Vitis species(He et al.1991).About42 species or7varieties originated from China.The study from our research group showed that some of them possess high resistance to powdery mildew and downy mildew(He et al. 1991;Wang et al.1995;Wang and He1997).Among them, Chinese wild V.pseudoreticulata accession‘Baihe-35-10 with excellent characteristics becomes an ideal candidate against E.necator(He et al.1991;Wang et al.1995;Wang and He1997).To understand the disease-resistance mech-anism,we constructed a cDNA library from Chinese wild V.pseudoreticulata‘Baihe-35-1’inoculated with E.neca-tor in2003,107clones were sequenced(Xu et al.2009).To obtain more defense-related genes from Chinese wild grape and study further the disease-resistance mechanism,we re-constructed the cDNA library here.3,500clones were sequenced,and1,727unigenes were obtained,including 280unigenes(16.2%)which have no signi?cant similarity with BLASTX analysis,which may be involved in the interaction of grapevine and pathogen.

WRKY proteins are a major family of plant transcription factors in plants,and play roles in regulating the responses to biotic and abiotic stresses,senescence,seed dormancy and seed germination(Rushton et al.,2012).They contain at least one conserved DNA-binding region WRKYGQK, designated the WRKY domain,and a zinc?nger motif (CX4-7CX22-23HXH/C).Based on the number of WRKY domains and certain features of the zinc?nger-like motifs, WRKY family members are divided into three groups(I,II, III)(Eulgem et al.2000).In different species,WRKY proteins were involved in multiple regulations of plant defense response.In rice,overexpression of OsWRKY23 resulted in enhanced expression of the pathogenesis-related (PR)genes and increased resistance to the bacterial patho-gen Pseudomanas syringae(Jing et al.2009).In Arabid-opsis,WRKY38and WRKY62are induced by virulent Pseudomonas syringae,and disease resistance is enhanced in the WRKY38and WRKY62single mutants and their overexpression reduced disease resistance and PR1 expression(Kim et al.2008).In addition,WRKY tran-scription factors also have a key role in abiotic stress. WRKY39overexpressing plants enhanced heat tolerance in Arabidopsis(Li et al.2010b).Overexpression of At-WRKY33or AtWRKY25increased the tolerance to NaCl stress(Jiang and Deyholos2009).

In grapevine(Vitis viniferal L.),98WRKY genes were identi?ed(Velasco et al.2007;Zhang et al.2011).To date, the function of?ve WRKY genes in grapevine,VpWRKY1, VpWRKY2,VvWRKY1,VvWRKY2and VvWRKY11,was reported on pathogen and abiotic stress.Two of them,VpWRKY1and VpWRKY2from our constructed library, participated in the response to biotic and abiotic stresses(Li et al.2010a).However,the mechanism of WRKY proteins involved in defense response in grapevines has not been completely elucidated.In the present study,we obtained a novel WRKY gene,designated as VpWRKY3,and generated transgenic tobacco plants with constitutive expression of the VpWRKY3gene from cauli?ower mosaic virus(CaMV) 35S promoter to characterize the resistance to biotic and abiotic stresses.Based on the previous research,we focused on the resistance to the pathogen,added the study of the tolerance of salt stress and ABA signaling so as to provide more clue for exploring the resistant mechanism. Materials and methods

Materials and treatment

Chinese wild V.pseudoreticulata‘Baihe-35-1’(E.necator-resistant)and‘Baihe-35-2’(E.necator-susceptible)were grown in the grape germplasm resources orchard of North-west A&F University,Yangling,Shaanxi,P.R.China.For pathogen-resistant experiments,8-week-old tobacco leaves (T1generation)were chosen to be inoculated with R.so-lanacearum according to the method described by Thilmony et al.(1995).For chemical and abiotic stress treatments, 3-month-old grapevine seedlings(Chinese wild V.pseudo-reticulata W.T.Wang‘Baihe-35-1’)were chosen with the expanded leaves and20–30cm in height in greenhouse.The grapevine seedlings growing in the greenhouse were sprayed with100l M salicylic acid(SA),0.5g/L ethephon,50l M MeJA and100l M abscisic acid(ABA)for0,2,4,6and8h, as well as water(Mock).For cold and heat treatments, grapevine seedlings were kept in illumination container at 4°C for0,2,4,6,8,10,12,24h,and44°C for0,2,4,6,8, 12h.Drought treatment was conducted by withholding water for0,1,2,3,4,5,6,7days.For mannitol and NaCl treatments,grapevine seedlings were watered with0.2M mannitol or0.15M NaCl for0,6,12and24h.For seed germination,sterilized tobacco seeds were cultured on MS medium supplemented with or without1l M ABA.For salt stress,surface-sterilized seeds of WT and T1transgenic VpWRKY3tobacco plants were sowed on MS medium for seed germination,after10days,they were transferred to MS medium containing0.2M NaCl for12days.Plant growth was tested to evaluate salt tolerance.

cDNA library construction

The young leaves from V.pseudoreticulata‘Baihe-35-1’were inoculated with E.necator according to the method described by Wang et al.(1995).And young leaves were sampled on

Plant Cell Rep

123

seven consecutive days after inoculation.Total RNA was extracted using the method described by Zhang et al.(2003). And pooled equal amounts of total RNA from leaves were used to construct the library according to the protocol provided by the SMART TM cDNA Construction Kit(Clontech).

Nucleic acid sequencing and analysis

Sequencing was run on3130XL sequencer(ABI Laborato-ries).All nucleic acid sequences were screened for bacterial sequences and vector/adapter sequences using the Cross-match software,and assembled into contigs with CAP3 (Huang and Madan1999).Homology searches were con-ducted using the BLAST program(BLASTX)in database of NCBI(https://www.sodocs.net/doc/0614666750.html,/BLAST/).Functional classi?cation analyses were performed according to the Gene Ontology(https://www.sodocs.net/doc/0614666750.html,).Putative protein domains were identi?ed using the InterProScan (https://www.sodocs.net/doc/0614666750.html,/).Putative nuclear localization signal was predicted with PSORT(http://psort.hgc.jp/form. html).Sequences of the other plant WRKY proteins were retrieved from GenBank database(http://www.ncbi.nlm. https://www.sodocs.net/doc/0614666750.html,).Phylogenetic tree was performed by the ClustalW method using DNAStar software.

Isolation of VpWRKY3cDNA

The full-length cDNA was ampli?ed by rapid ampli?cation of cDNA ends(BD Bioscience Clontech).Speci?c primers were designed based on the EST sequence(GenBank Accession No.GR883086).Primers GSP1:50CACCTTCTT CCACCTTAGCATCCATCTCA30for30RACE and GSP2: 50TCCTACGCAACTCTTCTACCAAACCACCA30for50 RACE were used to obtain the full length of VpWRKY3. RNA analysis

Semi-quantitative reverse transcription(RT)-PCR was performed at94°C for3min,28cycles of94°C for30s, 60°C for30s and72°C for30s,then followed by72°C for10min.Quantitative RT-PCR was run on an IQ5real time PCR Cycler(Bio-Rad Laboratories)with SYBRòGreen I dye.Reactions were the following thermal pro?le: 3min at94°C,40cycles of5s at94°C,30s at58°C. The relative mRNA ratios were calculated as2-DD CT(Li-vak and Schmittgen2001).Vitis actin gene was used as the internal control for the semi RT-PCR and qRT-PCR (Supplemental Table1).

Subcecullar location of VpWRKY3

The coding sequence of VpWRKY3without the termination codon was ampli?ed by PCR using primers(Forward50GGGCTCGAGATGGAATTCGAATTTATTG30and reverse50GGGGGTACCCCATTTTTCTATCTGAGT30) and then sub-cloned into the50-terminus of the coding region of green?uorescent protein(GFP)in the pBI221-GFP.The sequenced plasmid pBI221-GFP-VpWRKY3 was delivered into onion epidermal cells according to the method described by Mare et al.(2004).The location of the fusion protein was observed using a confocal microscope (LSM510;Carl Zeiss Thornwood,NY,USA).

Transactivation assay

The coding region of VpWRKY3was ampli?ed by PCR using the primers(forward50GGGCATATGGAATTCG AATTTATTGATAC30and reverse50GGGGTCGACTC ACCATTTTTCTATCTGAG30)and sub-cloned the Nde I-Sal I-digested fragment into the GAL4DNA-binding domain of the pGBKT7vector.The plasmid pGBKT7-VpWRKY3was transformed into AH109yeast cells.The transformed yeast cells were streaked on SD/-Trp and SD/-Trp/-Ade-His medium plates to observe yeast growth at30°C for3–4days.An assay of b-galactosidase activity was performed using X-gal.

Generation of VpWRKY3transgenic tobacco

The coding sequence of VpWRKY3was obtained by PCR. The forward primer sequence was50GGGGGATCCATG GAATTCGAATTTATTGA30,and the reverse primer was 50GGGGAGCTCTCACCATTTTTCTATCTGAG30.The PCR product was sub-cloned into vector pWRII(Yu et al. 2011).The obtained vector was introduced into Agrobac-terium tumefacien s strain GV3101by electrofusion method.The Nicotiana tabacum cv.NC89was transformed by the leaf disk method(Horsch et al.1985).Transgenic plants were selected on MS medium added with hygro-mycin(25mg L-1).T1generation of transgenic tobacco plants was used for further analysis.

Results

Construction of cDNA library and EST sequence analysis

To understand further the mechanism of the resistance to pathogen and abiotic stress,we reconstructed a cDNA library from V.pseudoreticulata‘Baihe-35-1’inoculated with E.necator(Supplemental Fig.1).3,500clones were randomly sequenced in the cDNA library.By trimming the vector and low-quality sequence,there obtained2,797 high-quality sequences,with an average EST read-length of650nucleotides(Supplemental Fig.2).Through CAP3

Plant Cell Rep

123

sequence assembly,1,727unigenes were obtained with364 contigs and1,363singletons.The unigene set was sub-mitted to the public databases(NCBI and SwissProt)for similarity analysis and assigned Gene Ontology(GO)cat-egories.All the nucleotide sequences were deposited at the NCBI GenBank database under the accession numbers GR882788–GR884514.762(44.2%)unigenes could be annotated and classi?ed into three domains based Gene ontology(GO):cellular component,molecular function and biological process(Supplemental Fig.3).For the cat-egory of molecular function,including binding(48.3%), catalytic activity(43.7%),structural molecular activity (14.2%),transporter activity(6.3%),transcription regu-lator activity(2.9%)and so on.In transcription regulator activity,22ESTs were identi?ed as transcription factors, including zinc?nger protein family,WD repeat-containing protein family,MYB family,WRKY family,ERF family, NAC family,HSF family,etc.,and we marked some transcription factors our research groups have studied and published in Table1.

Isolation and sequence analysis of VpWRKY3

Full length of VpWRKY3cDNA is1,280bp and contains a complete open reading frame of960bp encoding a puta-tive protein of320amino acids with a predicted protein molecular weight of35.4kDa.Sequence analysis showed that VpWRKY3contains one WRKY domain,one C2-HH zinc?nger motif(C-X5-C-X23-H-X1-H)and two predicted nuclear localization signal(RKRK,KKPR)(Fig.1). Compared with other Vitis WRKY proteins,VpWRKY3 shared only15.8,12.97,14.4,10.7and9.47%similarity with the reported VpWRKY1,VpWRKY2,VvWRKY1, VvWRKY2and VvWRKY11,respectively(Fig.2).Based on classi?cation method of Eulgem,the phylogenetic tree showed that VpWRKY3belonged to group IIa of the WRKY superfamily(Eulgem et al.2000)(Fig.3).

Subcellular localization of VpWRKY3

To con?rm the subcellular localization of VpWRKY3, pBI221-GFP-VpWRKY3protein was transiently trans-formed into onion epidermal cells.From Fig.4a,the fusion VpWRKY3protein was targeted to the nucleus of the onion epidermal cells.However,the control GFP protein was distributed throughout the cytoplasm and cell wall(Fig.4a). The results indicated that VpWRKY3is localized to nucleus.

Transcriptional activation activity of VpWRKY3

The assay of VpWRKY3transcriptional activation activity was showed in Fig.6.Yeast cells with the recombinant plasmid harboring VpWRKY3grew on SD/-Trp and SD/-Trp/-Ade/-His mediums and stained blue in X-gal solution,while the yeast cells with the vector control pGBKT7only grew on SD/-Trp medium(Fig.4b).These data demonstrated that VpWRKY3functioned as a transcriptional activator.

VpWRKY3response to pathogen and signal molecules

The WRKY transcription factor super-family has been suggested to regulate the defense response to pathogen infection(Eulgem and Somssich2007).To examine whe-ther VpWRKY3was involved in biotic stress,expression assays of VpWRKY3were conducted by quantitative RT-PCR in two grapevine genotypes including E.necator-resistant grapevine‘Baihe-35-1’and E.necator-susceptible ‘Baihei-35-2’.After infected with E.necator,VpWRKY3 transcript was signi?cantly induced until it reached the Table1ESTs identi?ed of transcription factors with putative functions

Accession

number

Predicted sequence

function(GO annotation)

Sequence

length(bp)

Note

GR882837BTF3b-like transcription

factor

730

GR883680Putative transcription factor809

GR884198Transcription factor910

GR884305Transcription factor861

GR883434WD40-like449

GR883002myb protein933

GR883395myb transcription factor890

GR883512MYB transcription factor

MYB73

715

GR883987myb-related transcription

factor MYBA22

828

GR882964MYB transcription factor

MYB142

533

GR883688Dehydration responsive

protein3

880

GR883086WRKY27671VpWRKY3 GR883935WRKY transcription factor

6

866VpWRKY1

GR883939WRKY44protein929VpWRKY2 GR883063NAC domain protein NAC6962VpNAC1 GR883700NAC domain protein NAC6950

GR884099Ethylene transcription factor860

GR884460Putative ethylene response

protein

464

GR883801Putative ethylene response

factor4

587

GR883677Pathogenesis-related

transcriptional activator

830

GR883674AT-HSFB2B865

GR884086YABBY-like transcription

factor

882

Plant Cell Rep

123

maximum level at 12h,and then decreased in the two grapevine genotypes (Fig.5a).

The response to pathogens is regulated by multiple signal transduction pathways,such as SA,jasmonic acid and ethylene.The effect of signal molecules on the expression of VpWRKY3was investigated by qRT-PCR.SA and ethylene induced an increase of VpWRKY3expression,and the maximum expression level appeared at the 8h.The maximum expression level induced by SA was higher than that of ethylene,whereas MeJA was hardly induced (Fig.5b),suggesting that VpWRKY3was regulated by SA and ethylene,and mainly by SA.

VpWRKY3enhanced the resistance to pathogen in transgenic tobacco plants

To con?rm the role of VpWRKY3in defense response,overexpressing VpWRKY3transgenic tobacco plants were generated (Fig.6a).Two T 1lines (OE1-3and OE1-5)were chosen on the basis of different accumulation level of VpWRKY3.Semi-RT-PCR of VpWRKY3in transgenic and wild tobacco plants was performed to assess the possible role of VpWRKY3in defense response.After inoculation with R.solanacearum ,the wild transgenic tobacco plants exhibited typical yellow lesions,while

VpWRKY3

Fig.1Sequence analysis of VpWRKY3.The WRKY motif is given in bold .The nuclear localization signal is

underlined .The cysteines and the histidine of zinc-?nger motif are boxed .The sequence has been deposited in GenBank (Accession No.JF500755)

Plant Cell Rep

123

transgenic tobacco plants showed few yellow lesions (Fig.6b).And we calculated leaf bacterial number per gram on the leaves of tobacco plants.Figure 6c showed that the leaf bacterial number per gram on wild type tobacco was higher than that of VpWRKY3transgenic tobacco lines.This result indicated that VpWRKY3gene has positive regulatory functions in defense pathways to prevent infection.

Expression pro?les of VpWRKY3induced by abiotic stress

Previous studies indicated that WRKY transcription factors are involved in response to a variety of abiotic stresses (Li et al.2010a ;Liu et al.2011;Mare et al.2004).In the current study,we subjected the expression pro?le of

0VvWRKY11 0VpWRKY1 20VpWRKY2 0VpWRKY3 0VvWRKY1 80VvWRKY2Consensus .....M .....A .....E .....N .....D .....E .....T .....S .....L .....S .....S .....S .....A .....S .....A .....S .....A .....S .....R .....A .....S .....A .....P .....L .....R .....P .....T .....I .....T .....L .....P .....P .....R .....S .....S .....M .....E .....T .....L .....F .....P .....G .....G .....P .....G .....F .....S .....P .....G .....P .....M .....T .....L .....V .....S .....N .....F .....F .....S .....D ..M ..N ..A ..D ..G ..P ..N ..D ..Q ..S ..S ..Y ..F ..C ..E ..R ..A ..S ..P ..F ..E ..S ..A ..Q ..E ..L ..K ..L ..A ..A ..E ..G ..P ..A ..N ..M ..P ..A ..E ..S 26VvWRKY11 0VpWRKY1 100VpWRKY2 0VpWRKY3 0VvWRKY1 160VvWRKY2Consensus ..S ..P ..D ..A ..S ..A ..G ..V ..S ..P ..D ..G ..S ..P ..D ..R ..S ..P ..A ..S ..E ..F ..S ..S ..G ..T ..S ..D ..E ..P ..D ..Q ..G ..V ..E ..S ..G ..A ..L ..S ..S ..S ..D ..K ..S ..E ..E ..D ..G ..R ..V ..T ..G ..S ..A ..V ..A ..D ..E ..A ..L ..A ..G ..G ..E ..D ..P ..F ..R ..E ..E ..F ..S ..R ..E ..F ..T ..K ..L ..Q ..A ..N ..V ..R ..A ..P ..S ..S ..S ..G ..I ..L ..T ..V ..E ..I ..S ..A ..G ..Q ..S ..S ..Q ..P ..L ..L ..L ..F M .S ..T A .G ..V V .S ..P E .A ..P L .L ..G L .N ..L G .S ..S F .T ..P S .A ..T K .Q ..C M .S ..L D .L ..L E .A ..D Q .S ..S I .V ..P A .E ..G I .F ..F Q .K ..F D .E ..S A .Q ..Q A .A ..G S .R ..P A .V ..F G .C ..V L .H ..M K .Q ..S 105VvWRKY11 0VpWRKY1 180VpWRKY2 16VpWRKY3 0VvWRKY1 240VvWRKY2Consensus S .E ..H M .V ..Q E .Q ..Q H .T ..A L .T ..L I .V ..A R .T ..Q M .A ..V L .Q ..T S .T ..A H .T ..Q Q .H ..A T .V ..A N .Q ..Q Q .T ..A N .K ..H H .K ..S N .Q ..H M .L ..M N .Q ..Q Q .S ..L L .S ..Q D .G ..A C .C ..E R .P ..F ..T ..P E .S ..S I .S ..S T .V ..L D .E ..S Y .L ..V T .S ..S V .P ..P S .T ..A K .S ..A F .V ..S K .T ..L K .Q ..T V .S ..Q I .I ..F S .Q ..P I .S ..S L .A ..F N .P ..A R .S ..S T .P ..N G .T ..T H .I ..K A .L ..A R .E ..H F .R ..E R .R ..Q R .P ..M G .S ..P P .P ..P V .F ..L S .P ..V S .K ..S S .A ..D D .N ..A S .S ..R P .E ..T S .C ..A S .M ..V S .P M .K T .E E .E S .G F .S S .N E .S V .Q F .G A .K I .L P .N D .S Q .S T .Q T .S S .S H .D L .D A .L G .Q L .K L .R T .T D .S P .I L .Q A .S K .P P .T P .S 168VvWRKY11 50VpWRKY1 255VpWRKY2 79VpWRKY3 0VvWRKY1 320VvWRKY2Consensus V .V N .S T .P P .F S .S P .T L .V A .V P .K N .D V .T S .K P .P L .P P .S G .A A .A D .D A .D F .D P .G S .G P .Y P .Y ..N K .N P .W R .W A .R G .R S .K D .K F .Y C .Y V .G V .G Q .Q D .Q R .K V .K Q M Q D .Q S E V V .V L R K D .K T H S M .G L T P E .S D D K R .E F A G K .Y T T S P .P K M R S .R P S S P .S N T Y V .Y L M Y L .Y V E K K .K S C C E .C S T T D .T N W Y T .H P S S G .P ..D ..S ..C ..C ..Y ..P ..A ..V ..K ..K .E K ..K .K I ..K .I E ..V .S C ..E .G C ..R .D D ..S V R D ..L S K S ..D S R G G .G D A Q L .Q V I V V .V V D I E .T S E E E .E T L I L .I S L I R .I Q R Y R .Y F G K M .K S R S S .G K S R T .Q E F H E .H S T N N .N F K H K .H G Q D K .Q L L P L .A S R P T .P Q S R E .L P V K M .P M L I L .N S V N S .K S G C I .R A G M M .A T D K C .K N Q E E .D ...N .T .....G .....N .....P .....N 239VvWRKY11 122VpWRKY1 332VpWRKY2 142VpWRKY3 49VvWRKY1 400VvWRKY2Consensus .....G .....N ..G ..S ..K ..N S .L ..F S .S ..Q F .P ..E M .I ..N S Q G ..P S E P Y .E I S V N .L T A T A .A G Q G L .S D D N H .Q G L S N .N S L T H .Q V A T L .T S K A K .G N I D E .N .L P L .L G R V M .N K S R R .K Q F M K .P G N L N .K S D N S .E S T D D .G L L S H M L F S D Q E P L I P L G A A L S F H Y P N T N Q S A S S S I L P G S R L S A E K K F K V S E R P K S N P K G D A E V A S Q G V Q E S Q K V E S K S P S T E S S P Q P D P Q L I L N A A S P I I N I S A P N P P S S ...E C G E .F H R Q R .P L K L K .P P R Y R N N G C S P I M S H P N H A S E G S G N D H W D S F S D H A S H E H G S G A E S R D N M M D R E N N D D S N T I D I E A E Y A S E E S K E G S I I S T K C K S A R Y E V S G G S S K D F D S G E E D E S K E D A K G S H S S G R S I S E E C T D K T D H K E K K E C D P P E P S R E R K D K R P E P P R G K S G K R C R T K R R Y R K K R .K T ..N .R K ..T .R K ..E .K S ..V 311VvWRKY11 174VpWRKY1 411VpWRKY2 213VpWRKY3 122VvWRKY1 479VvWRKY2Consensus .N S ..R ..L ..V ..G ..S ..N ..D ..S ..Q ..G ..V ..S .E S ..H .G S S .F .Q H R .K G K R V .P K K T K .G V I V K .K S R T T .K R K E I .P V H P R .K V R R V S F V F I P Q V K A I A S V T F V I L H E Q Q S I A K T T S R A S R T K I G D S S I T D N H E A P V S V V D N G L D D I F I L I L P H S L L L A D G K D D d D D D D D D E G G G G G y Y Y Y Y Y Y S A R Q R R w W W W W W W r R R R R R R k K K K K K K y Y Y Y Y Y Y g G G G G G G q Q Q Q Q Q Q k K K K K K K P .M V A V I .V T V V K .K R K K G .G D N G S .N N N N P .P P K P Y .H S F Y P .P P P P R .R R R R G .N A S S Y .Y Y Y Y Y .Y F Y Y K .R K R K C V C C C C S I T S T T S L S F Y N M N A A K P R A .P ..G K G T D G C H C C C C P Q P P N N A R V V V V R S R K K R K Y K K K K H Y H K Q H V R I V V V E C E Q Q E R T T R R R A H A S L A S K I A S A D H D E K T D D N D D D P Q T Q E P A G S S E K M C A L I A L M V L V V I A I I V I V T I A T T T K T T T T Y Q Y Y Y Y

338VvWRKY11 251VpWRKY1 488VpWRKY2 293VpWRKY3 151VvWRKY1 536VvWRKY2Consensus E V K E E E G Q G G G G E M I E I K H T H H H H S E D N T N H E H H H H S E D Q P D Q P M Q V V V .P P E P A .V S K A M P P P P A Q M K V T K E Y K E E S M K R V N S .T .S ...T .L ...Y .G ..I H H F F S P G G N E H H Q P R H N G H P A I T G T S A L A V C A T R N G K P P Q S L S L A M I V M V S Q A F L A V S S E K V L Y Q S S A S F K T S A P P P .Q P A I Q .I A S S N .M S M .V .V M A .V .E N S .D .N S P .K .S L R .K .T Q P .R .A F T .A .R K V .F .D K T .I .S T L .D .S E D .N .I A L .N .L F I .D .L Q Q .Q .S N P .C .F Q G .P .E I L .I .S S A .G .N S N .R .N T N .L .Q Q T .Q .D W A .L .D S K .K .S V N .E .N D S .E .A M V .Q .F E H .I .F G D .T .S E V ...S L K ...F A E ...P A K ...L E P ...I E V ...K L V ...Q D Q ...E P Q ...E G F ...E G L ....E V ...I K E ...P A Q ...N M M ...D E A ...D S S ...Q A S ...E R L ...V T T .. 338VvWRKY11 321VpWRKY1 499VpWRKY2 319VpWRKY3 151VvWRKY1 536

VvWRKY2Consensus

.T L R ...Y L D ...N S P ...N I S ...H G F ...T F T ...N E A ...N I A ....K L ....P A ...N C A ...N .A ...K .I ...N .S ...N .G ...N .R ...S .I ...S .L ...S .D ...S .Q ...D .T ...Y .Q ...L .I ...L .E ...S .K ...L .W ...E .....L .....T .....T .....S .....E .....S .....N .....L .....G .....S .....D .....H .....G .....D .....V .....L .....S .....G .......................V .....N .....S .....S .....C .....T .....D .....S .....T .....H .....S .....L .....D .....D .....M .....M .....M .....D .....F .....D .....D .....V .....F .....I .....G .....F .....E ....

Fig.2Amino acids sequence alignment of the VpWRKY3and other WRKY proteins,VpWRKY1(Accession No.ACY69975)and VpWRKY2(Accession No.ADD70008)from V.pseudoreticulata ,VvWRKY1(Accession No.AAT90397),VvWRKY2

(Accession No.AAT46067)and VvWRKY11(Accession No.CAP08302)from V .vinifera .Different shades mean different similarities,and the black boxes display the typical WRKY domain

Plant Cell Rep

123

VpWRKY3to different stresses to examine its role in abi-otic stresses.Under drought stress,strong VpWRKY3transcription level was detected at the 7th day (Fig.7a).

Low temperature (4°C),high temperature (44°C),man-nitol and NaCl treatments could also induce the expression of VpWRKY3compared with control (Supplementary Fig.3),but their induced levels were weaker than that of drought stress (Fig.7b–e).Treatment with ABA strongly induced the transcription of VpWRKY3compared with control (Fig.7f).And response to 1l M ABA,seed ger-mination of VpWRKY3transgenic tobacco was lower than that of wild tobacco (Fig.7h,i).Acquisition of salt tolerance in tobacco transgenic plants

Salt is an important factor affecting the growth and development of grapevine in saline soil.Improving salt tolerance of grapevine is of great signi?cance for grapevine production.As the VpWRKY3is induced by high salt,it was of our interest to con?rm the role in salt stress.10-day-old wild and transgenic tobacco seedlings were exposed on 0.2M NaCl for 12days.Transgenic tobacco seedlings were bigger compared with wild type tobacco seedlings (Fig.8a).The fresh weight of transgenic tobacco seedlings is heavier 2.1-fold and 3.3-fold than wild type tobacco (Fig.8b).Transgenic tobacco seedlings grew more lateral roots compared with wild type tobacco plants,but the length of root was similar to wild type tobacco plants.And the root number of transgenic tobacco seedlings is more 3.1-fold and 3.3-fold than wild type tobacco (Fig.8c).Lateral roots contribute to water uptake and facilitate the extraction of nutrients required for the growth and devel-opment of the plant.These results demonstrated that

Amino Acid Substitutions (100)

-Trp/-His/-Ade

pGBKT7pGBKT73Y K R W p V 3Y K R W p V 7T K B G p VpWRKY3

-Trp

-Gal

GFP

Merge

Bright field Green fluorescence VpWRKY-GFP

A

B

Fig.4a Nuclear localization of VpWRKY3.The photographs were taken in bright ?eld for cell morphology and in dark ?eld for green ?uorescence.The arrows point to the nucleus of the cells where GFP fusion proteins are localized.b Transactivation analysis of VpWRKY3in yeast.The vector pGBKT7was used as control.The culture solution of the transformed yeast was streaked on SD plate with or without histidine and adenine,and the b -galactosidase activity was checked.Three independent experiments were performed

Plant Cell Rep

123

VpWRKY3transgenic tobacco seedlings might enhance the resistance to high salt by inducing formation of more lat-eral roots.

Discussion

Constructing a cDNA library is an effective and rapid method to ?nd relevant genes and investigate their func-tions.Over 40%of the annotated unigenes were classi?ed into the ‘binding’category,which is associated with nucleotide/nucleic acid binding.RNA-binding proteins function in basic cellular processes and key regulators of gene expression,while DNA-binding proteins play a piv-otal role in various intra-and extra-cellular activities ranging from gene expression control to DNA repair (Babitzke et al.2009;Hazbun and Fields 2002).This indicated that nucleotide/nucleic acid binding proteins might play an important role in disease resistance of

Chinese wild grape.Furthermore,2.9%of the annotated unigenes were classi?ed into the ‘transcription regulator activity’category which contains MYB,NAC,WRKY,ERF and so on.Transcription factors play an important role in abiotic and biotic stresses by typically binding to DNA sequences and leading to the activation or repression of target genes.Our research group has been studying NAC (Zhu et al.2012),WRKY (Li et al.2010a ,b )and ERF family (in process),which are related to the resistance to pathogen.The results constituted a useful platform for understanding the mechanism of the transcription factors.In addition,280ESTs in the library have no signi?cant similarity,which will provide richer information for investigating the function of the new genes involved in pathogen defense.

Functions of WRKY proteins have been wildly inves-tigated in Arabidopsis (Kim et al.2008;Lippok et al.2007;Xu et al.2006;Zheng et al.2007).To date,only ?ve WRKY genes,including VvWRKY1,VvWRKY2,VvWRKY11,VpWRKY1and VpWRKY2in grapevine have been studied (Guillaumie et al.2010;Li et al.2010a ;Marchive et al.2007;Mzid et al.2007),among them,VpWRKY1and VpWRKY2were identi?ed in our cDNA library (Li et al.2010a ).Now,another WRKY gene was isolated from this library.Like other WRKY proteins in grapevine,VpWRKY3possessed the character of tran-scription factor which localizes to nucleus and functions as a transcriptional activator.But VpWRKY3has low

C

OE1-1WT OE1-2OE 1-3OE1-4OE1-5

WT OE1-3 OE1-5

Fig.6Biotic tolerance analyses of transgenic Plant Cell Rep

123

H

of VpWRKY3under abiotic stress and

in V.pseudoreticulata accession‘Baihe-35-Drought stress was conducted by withholding

days.b Cold treatment.Grapevine seedlings container at4°C for0,2,4,6,8,10,12,24h. Grapevine seedlings were kept in illumination 4,6,8,12h.d Mannitol treatment.Grapevine standard biological Surface-sterilized were plated

i Germination used for

bar value

Plant Cell Rep

123

sequence identity with other Vitis WRKY proteins,much different from VpWRKY1and VpWRKY2,although from the same library,suggesting that VpWRKY3is a novel WRKY gene in grapevine.

Members of the WRKY group IIa play important functions in regulating plant disease,such as AtWRKY18,AtWRKY 40and AtWRKY60.Overexpression of Arabidop-sis WRKY18in transgenic plants leads to constitutive PR gene expression and enhanced disease resistance to Pseu-domonas syringae (Chen and Chen 2002).Coexpression with WRKY40and WRKY60in Arabidopsis made plants more susceptible against both P .syringae and Botrytis cinerea (Xu et al.2006).Phylogenetic tree showed that VpWRKY3belongs to group IIa of the WRKY https://www.sodocs.net/doc/0614666750.html,pared with Arabidopsis WRKY proteins,VpWRKY3shares a higher similarity (44.3,43.7and 41.6%)with AtWRKY18,AtWRKY 40and AtWRKY60,and in grapevine,the four WRKY genes play a positive role in disease resistance (Li et al.2010a ;Marchive et al.2007;Mzid et al.2007),implying VpWRKY3may be involved in plant defense response.In our study,VpWRKY3was different in the expression pattern and level,compared with other ?ve studied grapevine WRKY genes.VpWRKY3was induced by pathogen,which is consistent with VpWRKY1and VpWRKY2(Li et al.2010a ;Marchive et al.2007;Mzid et al.2007).Interestingly,different from VpWRKY1,the maximum induction level of VpWRKY3was 1.95-fold

higher in susceptible genotype than in resistant genotype.After plants were attacked by pathogens,there exist sig-ni?cantly responses in susceptible plants and resistant plants,such as pathogen-induced transcriptional response.However,many genes showed strong evidence for tran-scriptional change in the susceptible V.vinifera and a much weaker response in the disease-resistant V.aestivalis when responded to powdery mildew (Fung et al.2008),which may account for why the induction level of VpWRKY3was higher in susceptible grapevines than in resistant ones.The disease resistance depends on multiple reactions from cytological level to molecular level in individual plant,including morphological characteristic of epidermal cell,signal transduction,the numbers,diversity and intensity of the genes related to disease resistance.Transcription factor is a key step in signal transduction pathway.WRKY transcription factors are a large family of regulatory pro-teins forming such a network (Eulgem and Somssich,2007).As a member of transcription factors,the high expression of VpWRKY3only demonstrated that it was involved in defense response.To con?rm the role of VpWRKY3in defense response,transgenic tobaccos were generated.Overexpression of VpWRKY3in tobacco plants increased the resistance to R.solanacearum in our study,suggesting that VpWRKY3functioned positively in defense response.

The response to pathogens is regulated by multiple signal transduction pathways,such as SA,jasmonic acid and ethylene.The present work argued that VpWRKY3was induced by SA and ethylene,and the maximum induction by SA was higher than that by ethylene.SA is a key signal molecule involved in systemic acquired resistance (SAR).Increase of endogenous SA can activate the expression of pathogenesis-related proteins and defense genes (Dempsey et al.1999).In Arabidopsis,49out of 72tested WRKY genes respond to SA treatment (Dong et al.2003).In grapevine,VvWRKY1was not only induced by ethylene and SA treatment but also H 2O 2(Marchive et al.2007).Above analysis indicated that SA signal pathway plays an important role in defense response of VpWRKY3,which is consistent with VpWRKY1and VpWRKY2.

Recently,many studies indicated that WRKY tran-scription factors have regulatory function in abiotic stress.In our paper,VpWRKY3was involved in abiotic stress,which was similar to WRKY genes in wheat,eight WRKY genes were responsive to low temperature,high tempera-ture,NaCl or PEG treatments.(Chen et al.2012).Over-expressing VvWRKY11in transgenic Arabidopsis seedlings may regulate positively the response to water stress (Liu et al.2011).WRKY proteins may act as activators or repressors as key components in ABA signaling (Xie et al.2005;Chen et al.2012).VpWRKY3strongly induced ABA and VpWRKY3transgenic tobacco increased the

45 r o o t

C

*

*

Plant Cell Rep

123

susceptibility to hormone ABA.Taken together our results, VpWRKY3transcription factor was involved in abiotic stress by activating ABA signal pathway.This is the?rst work to investigate the effect of ABA signaling on WRKY genes in grapevine.

Moreover,VpWRKY3transgenic tobacco seedlings might enhance the resistance to high salt by more lateral roots,which was consistent with OsWRKY8(Song et al. 2009).Plant hormone auxin represents a common signal that regulates the root development.In previous study, many transcription factors may control root development by altering auxin signaling-related genes(Falkenberg et al. 2008;Hagen and Guilfoyle2002).Whether and how VpWRKY3is involved in auxin signal pathway need further study.In our paper,we demonstrated that VpWRKY3may be associated with drought stress.Multiple roles of WRKY proteins under extreme conditions are like a network in plants,and we need further study to explore.

In conclusion,further evidence provided a clearer insight into the disease-resistant mechanism.VpWRKY3 was induced by pathogen E.necator and overexpression in tobacco plants increased the resistance to R.solanacearum. In addition,VpWRKY3transgenic tobacco increased the susceptibility to hormone ABA and enhanced the tolerance to salt.The above results suggested that VpWRKY3may participate in biotic and abiotic https://www.sodocs.net/doc/0614666750.html,pared with VvWRKY1,VvWRKY2,VpWRKY1and VpWRKY2, VpWRKY3also enhanced resistance to pathogen,and it is worthwhile to note that its expression in susceptible grapevine was induced signi?cantly.The mechanism of VpWRKY3on high temperature and ABA signaling in transgenic plants was investigated?rst to provide a new insight into exploring the molecular mechanisms of stress tolerance of WRKY genes.Furthermore,the cDNA library provided new useful genes and ESTs involved in disease defense,and the ESTs without signi?cant similarity will be worthwhile to study further.

Acknowledgments This work was supported by the National Nat-ural Science Foundation of China(Grant No.30971972). References

Babitzke P,Baker CS,Romeo T(2009)Regulation of translation initiation by RNA binding proteins.Annu Rev Microbiol 63:27–44

Chen C,Chen Z(2002)Potentiation of developmentally regulated plant defense response by AtWRKY18,a pathogen-induced Arabidopsis transcription factor.Plant Physiol129:706–716 Chen L,Song Y,Li S,Zhang L,Zou C,Yu D(2012)The role of WRKY transcription factors in plant abiotic stresses.Biochim Biophys Acta1819:120–128

Dempsey DA,Shah J,Klessig DF(1999)Salicylic acid and disease resistance in plants.Crit Rev Plant Sci18:547–575Dong J,Chen C,Chen Z(2003)Expression pro?les of the Arabidopsis WRKY gene superfamily during plant defense response.Plant Mol Biol51:21–37

Eulgem T,Somssich IE(2007)Networks of WRKY transcription factors in defense signaling.Curr Opin Plant Biol10:366–371 Eulgem T,Rushton PJ,Robatzek S,Somssich IE(2000)The WRKY superfamily of plant transcription factors.Trends Plant Sci 5:199–206

Falkenberg B,Witt I,Zanor MI,Steinhauser D,Mueller-Roeber B, Hesse H,Hoefgen R(2008)Transcription factors relevant to auxin signalling coordinate broad-spectrum metabolic shifts including sulphur metabolism.J Exp Bot59:2831–2846

Fung RWM,Gonzalo M,Fekete C,Kovacs LG,He Y,Marsh E,McIntyre LM,Schachtman DP,Qiu W(2008)Powdery mildew induces defense-oriented reprogramming of the transcriptome in a suscep-tible but not in a resistant grapevine.Plant Physiol146:236–249 Guillaumie S,Mzid R,Mechin V,Leon C,Hichri S,Destrac-Ivine A, Trossat-Magnin C,Delrot S,Lauvergeat V(2010)The grapevine transcription factor WRKY2in?uences the lignin pathway and xylem development into tobacco.Plant Mol Biol72:215–234 Hagen G,Guilfoyle T(2002)Auxin-responsive gene expression: genes,promoters and regulatory factors.Plant Mol Biol 49:373–385

Hazbun TR,Fields S(2002)A genome-wide screen for site-speci?c DNA-binding proteins.Mol Cell Proteomics1:538–543

He PC,Wang YJ,Wang G,Ren Z,He C(1991)The study on the disease-resistance of Vitis wild species originated in China.

Scientia Agric Sinica24:50–56(in Chinese)

Horsch RB,Fry JE,Eichlotz D,Rogers SG,Frakey RT(1985)A simple and general method for transferring genes into plants.

Science227:1229–1231

Huang X,Madan A(1999)CAP3:a DNA sequence assembly program.Genome Res9:868–877

Jiang Y,Deyholos MK(2009)Functional characterization of Arabidopsis NaCl-inducible WRKY25and WRKY33transcription factors in abiotic stresses.Plant Mol Biol69:91–105

Jing SJ,Zhou X,Song Y,Yu DQ(2009)Heterologous expression of OsWRKY23gene enhances pathogen defense and dark-induced leaf senescence in Arabidopsis.Plant Growth Regul58:181–190 Kim KC,Lai ZB,Fan BF,Chen ZX(2008)Arabidopsis WRKY38and WRKY62transcription factors interact with histone deacetylase 19in basal defense.Plant Cell20:2357–2371

Li H,Xu Y,Xiao Y,Zhu Z,Xie X,Zhao H,Wang Y(2010a) Expression and functional analysis of two genes encoding transcription factors,VpWRKY1and VpWRKY2,isolated from Chinese wild Vitis pseudoreticulata.Planta232:1325–1337

Li SJ,Zhou X,Chen LG,Huang WD,Yu DQ(2010b)Functional characterization of Arabidopsis thaliana WRKY39in heat stress.

Mol Cells29:475–483

Lippok B,Birkenbihl RP,Rivory G,Brummer J,Schmelzer E, Logemann E,Somissich IE(2007)Expression of AtWRKY33 encoding a pathogen-or PAMP-responsive WRKY transcription factor is regulated by a composite DNA motif containing W box elements.Mol Plant Microbe Interact20:420–429

Liu HY,Yang WL,Liu DC,Han YP,Zhang AM,Li SH(2011) Ectopic expression of a grapevine transcription factor VvWRKY11contributes to osmotic stress tolerance in Arabidop-sis.Mol Biol Rep38:417–427

Livak KJ,Schmittgen TD(2001)Analysis of relative gene expression data using real-time quantitative PCR and the2(T)(-Delta Delta C) method.Methods25:402–408

Marchive C,Mzid R,Deluc L,Barrieu F,Pirrello J,Gauthier A, Corio-Costet MF,Regad F,Cailleteau B,Hamdi S,Lauvergeat V (2007)Isolation and characterization of a Vitis vinifera tran-scription factor,VvWRKY1,and its effect on responses to fungal pathogens in transgenic tobacco plants.J Exp Bot58:1999–2010

Plant Cell Rep

123

Mare C,Mazzucotelli E,Crosatti C,Francia E,Stanca AM,Cattivelli L(2004)Hv-WRKY38:a new transcription factor involved in cold-and drought-response in barley.Plant Mol Biol55:399–416

Mzid R,Marchive C,Blancard D,Deluc L,Barrieu F,Corio-Costet MF,Drira N,Hamdi S,Lauvergeat V(2007)Overexpression of VvWRKY2in tobacco enhances broad resistance to necrotrophic fungal pathogens.Physiol Plant131:434–447

Rushton DL,Tripathi P,Rabara R,Lin J,Ringler P,Boken AK, Langum TJ,Smidt L,Boomsma DD,Emme NJ,Chen XF,Finer JJ,Shen QJ(2012)WRKY transcription factors:key components in abscisic acid signalling.Plant Biotechnol J1:2–11

Song Y,Jing S,Yu D(2009)Overexpression of the stress-induced improves osmotic stress tolerance in Arabidopsis.Chin Sci Bull 54:4671–4678

Thilmony RL,Chen ZT,Bressan RA,Martin GB(1995)Expression of the tomato Pto gene in tobacco enhances resistance to Pseudomonas-syringae Pv Tabaci expressing Avrpto.Plant Cell 7:1529–1536

Velasco R,Zharkikh A,Troggio M,Cartwright DA,Cestaro A,Pruss D,Pindo M,Fitzgerald LM,Vezzulli S,Reid J,Malacarne G, Iliev D,Coppola G,Wardell B,Micheletti D,Macalma T,Facci M,Mitchell JT,Perazzolli M,Eldredge G,Gatto P,Oyzerski R, Moretto M,Gutin N,Stefanini M,Chen Y,Segala C,Davenport C,Dematte L,Mraz A,Battilana J,Stormo K,Costa F,Tao Q, Si-Ammour A,Harkins T,Lackey A,Perbost C,Taillon B,Stella A,Solovyev V,Fawcett JA,Sterck L,Vandepoele K,Grando SM,Toppo S,Moser C,Lanchbury J,Bogden R,Skolnick M, Sgaramella V,Bhatnagar SK,Fontana P,Gutin A,Van de Peer Y,Salamini F,Viola R(2007)A high quality draft consensus sequence of the genome of a heterozygous grapevine variety.

PLoS One2:e1326

Wang YJ,He PC(1997)Study on the inheritance of resistance to powdery mildew in Chinese native wild Vitis L.species.Scientia Agric Sinica30:19–25(in Chinese)Wang YJ,Liu Y,He PC,Chen J,Lamikanra O,Lu J(1995) Evaluation of foliar resistance to Uncinula necator in Chinese wild Vitis species.Vitis34:159–164

Xie Z,Zhang ZL,Zou X,Huang J,Ruas P,Thompson D,Shen QJ (2005)Annotations and functional analyses of the rice WRKY gene superfamily reveal positive and negative regulators of abscisic acid signaling in aleurone cells.Plant Physiol 137:176–189

Xu XP,Chen CH,Fan BF,Chen ZX(2006)Physical and functional interactions between pathogen-induced Arabidopsis WRKY18, WRKY40,and WRKY60transcription factors.Plant Cell 18:1310–1326

Xu Y,Zhu Z,Xiao Y,Wang Y(2009)Construction of a cDNA library of Vitis pseudoreticulata native to China inoculated with Uncinula necator and the analysis of potential defence-related expressed sequence Tags(ESTs).South Afr J Enol Vitic 30:65–71

Yu Y,Xu W,Wang S,Xu Y,Li H,Wang Y,Li S(2011)VpRFP1,a novel C4C4-type RING?nger protein gene from Chinese wild Vitis pseudoreticulata,functions as a transcriptional activator in defence response of grapevine.J Exp Bot62:5671–5682 Zhang JJ,Wang YJ,Wang XP(2003)An improved method for rapidly extracting total RNA from Vitis.J Fruit Sci20(3):178–181(in Chinese)

Zhang H,Jin JP,Tang LA,Zhao Y,Gu XC,Gao G,Luo JC(2011) PlantTFDB2.0:update and improvement of the comprehensive plant transcription factor database.Nucleic Acids Res39: D1114–D1117

Zheng ZY,Mosher SL,Fan BF,Klessig DF,Chen ZX(2007) Functional analysis of Arabidopsis WRKY25transcription factor in plant defense against Pseudomonas syringae.Bmc Plant Biol7 Zhu ZG,Shi JL,He MY,Cao JL,Wang YJ(2012)Isolation and functional characterization of a transcription factor VpNAC1 from Chinese wild Vitis pseudoreticulata.Biotechnol Lett 34:1335–1342

Plant Cell Rep

123